Rechârge Biomedical Clinic

(note: there is an essential video that accompanies this post at the bottom of the page.)

Cancer is hard to define. Would-be cancer cells are routinely destroyed by your immune system prior to becoming clinically apparent.  That may have happened billions of times already but “if a tree falls in the woods, and no one hears it…”

Cancers can also fail to travel or invade very well, leading to cancers of “low malignant potential” that you can live with indefinitely, like Steve Jobs’ Neuroendocrine pancreatic cancer.

And if cancer-like behavior, such as loss of contact inhibition or uncontrolled replication, occurs in a telomerase-inactive cell, then its lineage is dead within 50 divisions due to the Hayflick limit, so who cares?

____________________________

What we can say without hesitation about both Cancer (and Aging) is that they may not be diseases like Scurvy (Vitamin C deficiency) or a Heart Attack (coronary artery blockage) but they are both the result of DNA damage which can be caused by radiation, oxidation, but most of all, telomere shortening and dysfunction.

Since it is Breast Cancer Awareness month, let’s look at the infamous “breast cancer gene,” or BRCA1.   A BRCA1 mutation is associated with a 60% chance of breast and ovarian cancer by age 90.  But did you know that “BRCA,” although it sounds like “breast cancer,” is really named after Berkeley, California?

Even more surprising, BRCA1 is no more a “cancer gene”  than policemen are crime-inducers. They don’t cause cancer but if they aren’t policing the DNA, cancers will develop.

This policeman’s role of BRCA1 is to keep the telomeres healthy and repair DNA breaks. That is what they do 99.99% of the time. When a breast ‘stem cell,’ which is already immortal by virtue of telomerase activation, loses its heterozygosity (LOH), it loses its only good copy of the BRCA1 gene and then the “bad” copy (or no copy) is all that is left.  As a result, the cell can no longer protect the telomeres and bad things happen.

LOH occurs with high frequency in BRCA1 patients who get cancer because chromosomes are not evenly segregated between a cells two daughters, a process described in the video about chromosome damage at the end of this posting.

———————————–

In your car, friction causes your pistons to wear out, the brakes to fail, and the tires to go bald.

Just as motion creates friction in your car, so replicative senescence grinds down the cells in your body.  Cells are constantly “in motion” because they must copy their 46 chromosomes 50 billion times a day. With each division, telomeres shorten and that’s why cells age.

Analogies are not even needed when it comes to radiation and oxidative stress. Radiation can cause DNA breaks just as radiation causes paint to crack and upholstery to fade. And oxidation causes DNA damage in cells just as it causes rust to your undercarriage.

————Other cancer syndromes

In addition to BRCA, there are other gene defects which can cause cancer syndromes and they often relate to DNA repair, such as the Retinoblastoma protein and P53 (Li-Fraumeni Syndrome).

When I say there is only one cause of breast cancer, I mean that DNA damage is the sina qua non of all cancers. And when I say there are many cures, just look at this chart because all of these pathways are constantly at work to repair DNA or cause cell apoptosis (forced death) in order to prevent cancer. When any of them are disabled, as in the case of BRCA1 gene mutation, your DNA surveillance is compromised and like a city without cops, crime ensues.

Interestingly, 10 of 11 premature aging syndromes (aka Progerias) are related to DNA repair problems as I describe in this video, so the premature aging and the premature cancer syndromes are cut from the same cloth: failure of DNA repair and/or cell apoptosis.

Now that we have a telomerase activator in TA-65, we can assist DNA repair by preventing the telomere decay that causes breaks and incorrect chromosome separation at cell division.  Don’t let another day pass without naturally recharging your stem cells by safely activating your telomerase.

——————————

To really increase your breast cancer awareness, you must watch this video which explains how DNA damage occurs and explains why cancer-prevention genes like BRCA1 are so essential.

OnToplist is optimized by SEO
Add blog to our blog directory

(note: there is a video that accompanies this post at the bottom)

A Nobel Prize for a stinking Label maker? Last year’s Nobel Prize in Medicine was awarded for the discovery of the enzyme called telomerase, which nearly all plants and animals use to manufacture longer protective ends, call telomeres.

Without telomerase, you would die of old age at about 12 years old.

So what is telomerase?  Remember having to label your gym locker or maybe your lunchbox with one of these?

old school label maker

These Dymo labelers were pretty cool and they punched out letters by pressing hard, then advancing to the next slot. Telomerase, shown here, is the same type of device but it only has four letters: A for Adenine, T for Thymine, G for guanine and C for cytosine.

telomerase prints longer tapes

The telomere is the repeating message that loops back to cap and protect the ends of the chromosomes. Without them, the cell’s many repair mechanisms would treat the ends like damaged DNA and cause a lot of problems by trying to repair them.

the 3' end is looped back

Note that the Telomere overhangs about 200 base pairs on the “sense” strand, which loops back to keep the end from dangling.  It is called 5′ (“five prime”) to 3′ (“three prime”) because that is the direction DNA is read and assembled. It can’t be done in reverse. It is called the Leading strand because at the replication fork, it is made with ease, whereas the 3′ to 5′ strand lags (hence the name of Lagging strand) and limits the speed because of the piecemeal process described here.

The 5′ to 3′ half of the double helix is called the “sense” strand because it contains the genetic coding, which plays like music (in contrast to the 3′ to 5′ matching stand which, if it could be read, would be unintelligible, like Stairway to Heaven played in reverse.)

where are your shoes, Mr. Walrus?

So just what is the message of the telomeric DNA?  Since it doesn’t encode any of the music (i.e. genes,) it just repeats like The Beatles’ “number nine? number nine? number nine?” over and over but in doing so, is serving the same critical function as the leader on a blank tape.

telomeres are like leaders

For humans, the message is “TTAGGG,” over and over again, and that song remains the same for all animals with a backbone. For other critters, like yeast, the repeating message is “GGTGTACGGATGTCTAACTTCTT” (23 base pairs) over and over again. For insects, it’s only 5 base pairs: “TTAGG,” and for most plants, its 7 base pairs (“TTTAGGG”). But almost all eukaryotes (animals whose cells have nuclei) use telomerase to lengthen telomeres, and all eukaryotes need some version of telomere repeats to protect the tips of their chromosomes.

If you were copying taped music but could only press the recording button on the duplicate after pressing the play button on the original, you would have a perfect model for the telomere theory of aging. Every recording is a bit shorter on the duplicate until inevitably you would be losing music. And when the music’s over…turn out the lights for that cell.

————————————————

For extra credit, read on:

circular DNA

Bacteria don’t need telomeres because their DNA is circular so there aren’t any  5′ nor 3′  ends although there is still a sense and antisense distinction. Circular DNA is easily copied, as shown here:

——————–

But bacteria are all single-celled and although they don’t know the difference, you just can’t do very interesting things without cell specialization and cooperation.

Bacteria are all the same so it’s ‘every man for himself.’ That’s because they have the same DNA and the same programming. The only nice thing about being a bacteria? They don’t have to copy, maintain, and repair a huge DNA library. At some point in evolution of life on this planet, cells ‘invented’ nuclei, where genetic information could be relatively sheltered, and the DNA became much longer and organized in a linear fashion, as double helices wrapped around spools and packed together tightly except in areas of active gene usage. Having huge libraries allows for cell specialization (differentiation) and cooperation (by contact, electricity, chemical signals, division of labor, and formation of specialized organs) and that makes it possible to make every creature, from the aardvark to the zebra.

————————

Click here for a video in which Dr. Park explains more: