Archive for the 'Uncategorized' Category

21 NovPODCAST 14 – Obesity

Recharge Biomedical “PODCAST 14: Obesity”

Dr. Ed Park of Recharge Biomedical explains why Obesity results from cellular aging

10 DecIs the Surgeon General Overreaching?

Yesterday, on December 9th, the Surgeon General released a 704 page report explaining that smoking is bad for you. The headlines were “A single cigarette can kill you” and  “85% of all lung cancer is caused by smoking.”

Regarding cancer, I definitely agree with these two statements in the executive summary:

“6. Exposure to cigarette smoke carcinogens leads to DNA damage and subsequent mutations in TP53 and KRAS in lung cancer.

7. There is consistent evidence that smoking leads to the presence of promoter methylation of key tumor suppressor genes such as P16 in lung cancer and other smoking-caused cancers.”


Failed DNA repair – the common theme for Cancer and Aging

Have you noticed that when someone gets lung cancer, the question that always follows is “was he/she a smoker?”  No one asks if the person lived near radon or had unhealthy lifestyles (poor nutrition, stress, lack of exercise) that shorten telomeres.  Have you ever heard of a partner getting cancer a year after their spouse died of cancer?  We know that Cancer isn’t contagious, so how is that possible?  I believe the stress they went through must have inhibited their telomerase activity, allowing their telomeres to erode more rapidly.

Yesterday’s report states that 85% of lung cancer is caused by smoking.  But this conflicts with most previous studies showing that the majority of deaths from lung cancer are NOT statistically attributable to smoking?  It could also be that 85% of all people have tried a cigarette and that is why 85% of all lung cancer patients have a smoking history. But is that causation?

Perhaps for our own good, the report declares that a single cigarette can kill you.  But note that the same statistical, but not necessarily causal, association would exist between the percent of American’s who have kicked a soccer ball and any other disease group you wish to study.  For example 85% of people who are struck by lightening have kicked a soccer ball.   85% of people who lose a limb in industrial machinery accidents have kicked a soccer ball…etc.

The following paragraph more closely resembles the traditional epidemiological dogma with regard to smoking and lung cancer:

“52.2% and 14.8% of lung cancer deaths were attributable to current and former cigarette smoking, respectively. In females, the corresponding figures were 11.8% and 2.8%. Among current male smokers, the relative risk was strongly correlated with the intensity and duration of cigarette smoking. “

Ando et al, International Journal of Cancer, Volume 105, Issue 2, pages 249–254, 10 June 2003

—————————————–

"There are three kinds of lies: lies, damned lies, and statistics."

I am not trying to say smoking is not bad for you.  It most certainly is.  But it is also important that epidemiology not be distorted to further an anti-smoking agenda.

People often conceptualize cancer as a genetic lottery or moral retribution.  But as I explain in this video, I believe that Cancer’s are largely made possible by telomere erosion and failed immune surveillance.  Here are some other facts that may surprise you:

  • Did you realize that 2/3 of people with any cancer don ‘t have a prior family history for that particular cancer?
  • Did you realize that if you live long enough, you will get cancer of every organ?  It’s just like if you drive your car for 1,000,000 miles, all the car parts will fail.  When you change the transmission at 400,000 miles, you don’t blame abuse of the car or remember that your sister’s transmission failed as well.

To reiterate, smoking does cause lung cancer and many other illnesses and is a bad thing to do.   But as this JAMA article suggests, the telomere erosion occurring in all stem cells is probably the major mechanism for cancer formation in all your organs and is reversible by telomerase activation, whether by TA-65 or other healthy lifestyle choices.

Old paradigms must make way for newer ones.  There are currently 3,924 articles that come up when you type “telomere and cancer” into PubMed.  Academics advance science incrementally. “Publish or perish.”   But you can take advantage of a safe and natural quantum leap in DNA repair.   “Refurbish or perish” should be your motto and that’s not just spin doctoring.

12 OctBreast Cancer: One Cause yet so Many cures

(note: there is an essential video that accompanies this post at the bottom of the page.)

Cancer is hard to define. Would-be cancer cells are routinely destroyed by your immune system prior to becoming clinically apparent.  That may have happened billions of times already but “if a tree falls in the woods, and no one hears it…”

Cancers can also fail to travel or invade very well, leading to cancers of “low malignant potential” that you can live with indefinitely, like Steve Jobs’ Neuroendocrine pancreatic cancer.

And if cancer-like behavior, such as loss of contact inhibition or uncontrolled replication, occurs in a telomerase-inactive cell, then its lineage is dead within 50 divisions due to the Hayflick limit, so who cares?

____________________________

What we can say without hesitation about both Cancer (and Aging) is that they may not be diseases like Scurvy (Vitamin C deficiency) or a Heart Attack (coronary artery blockage) but they are both the result of DNA damage which can be caused by radiation, oxidation, but most of all, telomere shortening and dysfunction.

Since it is Breast Cancer Awareness month, let’s look at the infamous “breast cancer gene,” or BRCA1.   A BRCA1 mutation is associated with a 60% chance of breast and ovarian cancer by age 90.  But did you know that “BRCA,” although it sounds like “breast cancer,” is really named after Berkeley, California?

Even more surprising, BRCA1 is no more a “cancer gene”  than policemen are crime-inducers. They don’t cause cancer but if they aren’t policing the DNA, cancers will develop.

This policeman’s role of BRCA1 is to keep the telomeres healthy and repair DNA breaks. That is what they do 99.99% of the time. When a breast ‘stem cell,’ which is already immortal by virtue of telomerase activation, loses its heterozygosity (LOH), it loses its only good copy of the BRCA1 gene and then the “bad” copy (or no copy) is all that is left.  As a result, the cell can no longer protect the telomeres and bad things happen.

LOH occurs with high frequency in BRCA1 patients who get cancer because chromosomes are not evenly segregated between a cells two daughters, a process described in the video about chromosome damage at the end of this posting.

———————————–

In your car, friction causes your pistons to wear out, the brakes to fail, and the tires to go bald.

Just as motion creates friction in your car, so replicative senescence grinds down the cells in your body.  Cells are constantly “in motion” because they must copy their 46 chromosomes 50 billion times a day. With each division, telomeres shorten and that’s why cells age.

Analogies are not even needed when it comes to radiation and oxidative stress. Radiation can cause DNA breaks just as radiation causes paint to crack and upholstery to fade. And oxidation causes DNA damage in cells just as it causes rust to your undercarriage.

————Other cancer syndromes

In addition to BRCA, there are other gene defects which can cause cancer syndromes and they often relate to DNA repair, such as the Retinoblastoma protein and P53 (Li-Fraumeni Syndrome).

When I say there is only one cause of breast cancer, I mean that DNA damage is the sina qua non of all cancers. And when I say there are many cures, just look at this chart because all of these pathways are constantly at work to repair DNA or cause cell apoptosis (forced death) in order to prevent cancer. When any of them are disabled, as in the case of BRCA1 gene mutation, your DNA surveillance is compromised and like a city without cops, crime ensues.

Interestingly, 10 of 11 premature aging syndromes (aka Progerias) are related to DNA repair problems as I describe in this video, so the premature aging and the premature cancer syndromes are cut from the same cloth: failure of DNA repair and/or cell apoptosis.

Now that we have a telomerase activator in TA-65, we can assist DNA repair by preventing the telomere decay that causes breaks and incorrect chromosome separation at cell division.  Don’t let another day pass without naturally recharging your stem cells by safely activating your telomerase.

——————————

To really increase your breast cancer awareness, you must watch this video which explains how DNA damage occurs and explains why cancer-prevention genes like BRCA1 are so essential.


New Leaf Healing
OnToplist is optimized by SEO
Add blog to our blog directory

07 OctIs Paul Dead? (or were his telomeres just too short?)

(note: there is a video that accompanies this post at the bottom)

A Nobel Prize for a stinking Label maker? Last year’s Nobel Prize in Medicine was awarded for the discovery of the enzyme called telomerase, which nearly all plants and animals use to manufacture longer protective ends, call telomeres.

Without telomerase, you would die of old age at about 12 years old.

So what is telomerase?  Remember having to label your gym locker or maybe your lunchbox with one of these?

old school label maker

These Dymo labelers were pretty cool and they punched out letters by pressing hard, then advancing to the next slot. Telomerase, shown here, is the same type of device but it only has four letters: A for Adenine, T for Thymine, G for guanine and C for cytosine.

telomerase prints longer tapes

The telomere is the repeating message that loops back to cap and protect the ends of the chromosomes. Without them, the cell’s many repair mechanisms would treat the ends like damaged DNA and cause a lot of problems by trying to repair them.

the 3' end is looped back

Note that the Telomere overhangs about 200 base pairs on the “sense” strand, which loops back to keep the end from dangling.  It is called 5′ (“five prime”) to 3′ (“three prime”) because that is the direction DNA is read and assembled. It can’t be done in reverse. It is called the Leading strand because at the replication fork, it is made with ease, whereas the 3′ to 5′ strand lags (hence the name of Lagging strand) and limits the speed because of the piecemeal process described here.

The 5′ to 3′ half of the double helix is called the “sense” strand because it contains the genetic coding, which plays like music (in contrast to the 3′ to 5′ matching stand which, if it could be read, would be unintelligible, like Stairway to Heaven played in reverse.)

where are your shoes, Mr. Walrus?

So just what is the message of the telomeric DNA?  Since it doesn’t encode any of the music (i.e. genes,) it just repeats like The Beatles’number nine? number nine? number nine?” over and over but in doing so, is serving the same critical function as the leader on a blank tape.

cassette leader

telomeres are like leaders

For humans, the message is “TTAGGG,” over and over again, and that song remains the same for all animals with a backbone. For other critters, like yeast, the repeating message is “GGTGTACGGATGTCTAACTTCTT” (23 base pairs) over and over again. For insects, it’s only 5 base pairs: “TTAGG,” and for most plants, its 7 base pairs (“TTTAGGG”). But almost all eukaryotes (animals whose cells have nuclei) use telomerase to lengthen telomeres, and all eukaryotes need some version of telomere repeats to protect the tips of their chromosomes.

If you were copying taped music but could only press the recording button on the duplicate after pressing the play button on the original, you would have a perfect model for the telomere theory of aging. Every recording is a bit shorter on the duplicate until inevitably you would be losing music. And when the music’s over…turn out the lights for that cell.

————————————————

For extra credit, read on:

circular DNA

circular DNA

Bacteria don’t need telomeres because their DNA is circular so there aren’t any  5′ nor 3′  ends although there is still a sense and antisense distinction. Circular DNA is easily copied, as shown here:

——————–

But bacteria are all single-celled and although they don’t know the difference, you just can’t do very interesting things without cell specialization and cooperation.

Bacteria are all the same so it’s ‘every man for himself.’ That’s because they have the same DNA and the same programming. The only nice thing about being a bacteria? They don’t have to copy, maintain, and repair a huge DNA library. At some point in evolution of life on this planet, cells ‘invented’ nuclei, where genetic information could be relatively sheltered, and the DNA became much longer and organized in a linear fashion, as double helices wrapped around spools and packed together tightly except in areas of active gene usage. Having huge libraries allows for cell specialization (differentiation) and cooperation (by contact, electricity, chemical signals, division of labor, and formation of specialized organs) and that makes it possible to make every creature, from the aardvark to the zebra.

————————

Click here for a video in which Dr. Park explains more:

26 SepPremature aging is caused by…DNA damage

There are 11 syndromes that result in premature aging, or PROGERIAS (pro- towards / geria – elderly).  Scientists have determined the genetic and molecular causes for them, so what can those details tell us about aging in general?

——————– THE PROGERIAS

(adapted from a chart from: “Shared Phenotypes Among Segmental Progeroid Syndromes Suggest Underlying Pathways of Aging,”
Hofer, AC et al , J Gerontol A Biol Sci Med Sci (2005) 60 (1): 10-20)

You may notice that only four of the Progerias show accelerated telomere shortening, but since 10 of 11 involve DNA maintenance problems, I believe a Telomere theory of aging still applies insofar as telomeres are made of DNA and therefore a subset of DNA maintenance.  My own version of the telomere theory of aging can be found at the bottom of this page from my website: http://www.rechargebiomedical.com/aging.html

Here is a closer examination of Progerias by molecular etiology:

1) Helicases (in Blue above) are enzymes (like nanomachines) needed to unwind the double helix for all manner of DNA processing

2) DNA Transcription (in Orange) is the matching of complimentary strands for existing sequences (reading GGGTTA causes a ‘writing’ or transcription of CCCAAT on the opposing strand). Removal and repair of ‘typographic’ errors.

3) DNA Repair (in Red) fixes breaks in DNA, caps the telomeres, and permits checkpoints to hypnotize or kill off genetically-damaged cells.

4) Nuclear membrane integrity (in Yellow) is poor, making chromosome sorting and synthesis difficult

5) Telomerase dysfunction (in Green) allow for rapid shortening and uncapping of chromosome ends

——————-
Q: So what do all these cell processes have in common?

A: They all cause poor maintenance of our genetic integrity.

To quote from my older blog post:
“There are 50 billion cell divisions x 6 billion base pairs copied per cell division every day. This means there are 300 quintillion (300,000,000,000,000,000,000) chances to make a mistake every day.”
http://www.rechargebiomedical.com/blog/uncategorized/288/

But the biggest problems are probably not from simple transcription “typos” but rather when telomeres become critically short, or uncapped.  Uncapped DNA triggers repair mechanisms because the repair systems see them as DNA breaks which must then be joined together.

When the cell divides the next time, the fused chromosome is torn apart like trapeze artists that can’t let go, because the points of failure after end-to-end chromosome fusion are no longer the natural “fingertips”.

——————
Now that you understand that premature aging, we can apply the same principles to  regular aging, which simply reflects loss of data integrity made possible by telomere attrition (both from replicative senescence and oxidation) and by poor DNA repair and transcription in general.

By taking TA-65, you will recharge your telomeres and that is always a good thing. Call now before any more of your stem cell chromosomes become uncapped.

As a new feature to these blog posts, I’m offering this video ‘walk through’ of the main ideas. Click the image below to view it.

Progeria video

Premature Aging Syndromes

If you found this post and/or video interesting, please forward it to a friend. Thanks!

Here is the link to the complete DNA transcription video